Cell culture
Hela, Hela-ACE2 cells were maintained in DMEM (MACGENE Tech Ltd., Beijing, China) supplemented with 10% fetal bovine serum (FBS) (ExCell Bio, Shanghai, China) plus a final concentration of 1% Penicillin–Streptomycin (MACGENE Tech Ltd., Beijing, China) or without antibiotics when transfection. Cells were incubated at 37 °C, 5% CO2.
Constructs
The codon-optimized SARS-CoV-2 S cDNA was synthesized at Genscript Biotech Corporation (Nanjing, China). The wild type S gene of SARS-CoV-2 was cloned into pSecTag2-Hygro-A vector through seamless homologous recombination. Human ACE2 genes were cloned into the self-inactivating retroviral vector plasmids, pQCXIP-Puro to generate pQCXIP-ACE2-Puro. Retroviral helper plasmids VSV-G, Gap-pol-Rev were from Addgene. All constructs were verified by DNA sequencing with detail information as below:
Plasmid name | Construct method | Vector backbone | Cutting site | DNA | Primer Sequence (5′ → 3′) |
---|
pSecTag2-COV2-S | Homologous recombination | pSecTag2 Hygro A | XhoI | COV2-S | AGCTTGGTACCGAGCTCgCAGTGCGTCAATCTGACAACTCG |
BamHI | TTCGGGCCCTCCTCGAGCGGTGTAATGCAGCTTCACGC |
pQCXIP-ACE2 | Homologous recombination | pQCXIP-VCL-Full length | SbfI | ACE2 | CATTGGAACGGACCTGCAgccaccATGTCAAGCTCTTCC |
Not | attatgatctagagtcgCtcaCTTGTCATCGTCATCCTTGTAGTCg |
Generation of ACE2-expressing cells
For stable ACE2-expressing Hela cells, 293FT cells were co-transfected with the retroviral vector and retroviral helper plasmids to make retroviral particles that were subsequently used to infect Hela cells. Cells stably expressing ACE2 (Hela-ACE2) were selected in the presence of 8 μg/mL puromycin. The expression of ACE2 was confirmed by Western blot.
Syncytium formation assay
Syncytium formation assay was performed as described previously [10] with slight modification. About 4.0 × 105 Hela-ACE2 cells per well were seeding in 6-well plate precoated with type I collagen (354236, BD Bioscience). After 16 h culture, cells were then transfected with spike constructs by Lipofectamine LTX and PLUS™ reagent (2250382, Thermal Fisher Scientific, US) to induce syncytia.
The 2019-CoV-2 (GenBank ID: MT627325), a clinical isolate of SARS-CoV-2 virus, was propagated in Vero E6 cells, and viral titer was determined by 50% tissue culture infective dose (TCID50) using immunofluorescence assay. Hela-ACE2 cells (4 × 105 cells/well) in 6-well Cell culture plate were first infected with SARS-CoV-2 (MOI of 0.1) for 24 h, and then cultured in normal medium overnight to form syncytia. All the SARS-CoV-2 infection experiments were performed in a biosafety level-3 (BLS-3) laboratory in the Department of Microbiology at the 2nd Military Medical University. Images of 4 random fields (10 × objective lens) were taken on Hoechst-stained cells 24 h post transfection by Nikon microscope. Nucleus counting was performed by NIS elements AR software (Nikon, Japan). The fusion index (FI) was calculated as “% of nuclei in fused cells”.
Western blotting
Cells were lysed on ice with cold RIPA buffer containing phosphatase-protease and protease inhibitors (CWBiotech, Beijing) for 20 min followed by ultrasonic disruption (power 40%, work 6 s, pause 9 s, 4 times in total). After being centrifuged at 12,000 rpm for 10 min, the supernatant was collected for SDS-PAGE electrophoresis followed by transferring onto the PVDF membrane (0.2 μm, Millipore). The PVDF membrane, blocked with 5% skimmed milk (BD, USA) or 5% bovine serum albumin (BSA) (Sigma, USA) for 1 h at room temperature, was then blotted with primary antibodies in 5% BSA for 12 h at 4 °C or 4 h at room temperature, followed by one-hour secondary antibodies at room temperature.
The primary antibodies used: ACE2 (Proteintech, 1:3000, 66699-1-Ig), SARS-CoV2 (COVID-19) spike (GeneTex, 1:2000, GTX632604), Anti-STING antibody (Abcam, 1:1000, ab181125), Phospho-STING (Ser366) (E9A9K) (CST, 1:1000, 50907T), cGAS (CST, 1: 1000, 79978S), phospho-CGAS-Y215 (Abclonal, 1:1000, AP0946), IRF-3 (CST, 1:1000, 11904T), Phospho-IRF-3 (Ser386) (CST, 1:1000, 37829T), p53(DO-1) (Santa Cruz, 1:1000, Sc-126), β-Actin (Proteintech, 1:5000, 60008-1-lg), Phospho-Histone H2AX-S139 (Abclonal, 1:1000, AP0099). The secondary antibodies used: anti-rabbit IgG HRP (CST, 1:3000, #7074), anti-mouse IgG HRP (CST, 1:3000, #7076).
Immunofluorescence and quantification
Cells were grown on glass coverslips and fixed in 4% paraformaldehyde in PBS for 10 min at room temperature, followed by 5-min washes for three times with PBS, and permeabilized with 0.2% Triton X-100 in PBS for 5 min. After three-time washing, cells were blocked in 5% BSA in PBS for 1 h at room temperature. Cells were then incubated with primary antibodies diluted in 5% BSA in PBS supplemented with 0.1% Tween 20 (PBST) overnight at 4 °C or 1 h at room temperature. Then, cells were washed four times with PBS, each for 10 min, followed by incubation with Alexa Fluor-conjugated secondary antibody (Life Technologies, USA), in 5% BSA/PBST for 1 h at room temperature.
The following primary antibodies were used for immunofluorescence: Phospho-Histone H2AX-S139 (Abclonal, 1:100, AP0099), IRF-3 (CST, 1:200, 11904T), cGAS (CST, 1: 200, 79978S). Secondary antibodies, anti-rabbit-Alexa488 (2256692), and anti-rabbit-Alexa647 (A11036) (Invitrogen), were used at 1:500 dilution. All slides were stained with DAPI (ZSGB-BIO, ZLI-9557) and Alexa Fluor®568 Phalloidin (1:200, Life technologies, A12379) to indicate nuclei and actin, respectively. Images were captured and processed by Ultraview Vox confocal system (Perkin Elmer) or Widefield Fluorescence system (Nikon, Japan) on Nikon Ti-E microscope. Blind scoring was performed.
Reverse transcription-quantitative PCR (RT-qPCR)
Total RNA was extracted with RNAiso Plus (TaKaRa, Japan) according to the manufacturer’s manual. Reverse transcription (RT) was done using TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix (TransGen Biotech, China), and then quantitative PCR (qPCR) was performed using SYBR Green Realtime PCR Master Mix (TOYOBO, Japan) on an qTOWER3G machine (Analytik Jena AG, Germany). The expression of target genes was normalized to the housekeeping gene GAPDH. The following primers (5′–3′) were used for RT-qPCR:
-
IFIT2: AAGCACCTCAAAGGGCAAAAC, TCGGCCCATGTGATAGTAGAC;
-
IFNβ1: GCTTGGATTCCTACAAAGAAGCA, ATAGATGGTCAATGCGGCGTC;
-
CCL5: CCAGCAGTCGTCTTTGTCAC, CTCTGGGTTGGCACACACTT;
-
CXCL10: TAAGTGGCATTCAAGGAGTA, TGGATTCAGACATCTCTTCTC;
-
NOXA: GCTGGAAGTCGAGTGTGCTA, CCTGAGCAGAAGAGTTTGGA;
-
GADD45A: AGAAGACCGAAAGCGACCC, GTTGATGTCGTTCTCGCAGC;
-
SLC7A11: GCTGGGCTGATTTATCTTCG, GAAAGCTGGGATGAACAGT;
-
PAI1: CCGCCGCCTCTTCCA, GCCATCATGGGCACAGAGA;
-
MYC: GGCTCCTGGCAAAAGGTCA, CTGCGTAGTTGTGCTGATGT;
-
GAPDH: GGAGCGAGATCCCTCCAAAAT, GGCTGTTGTCATACTTCTCATGG;
Statistics
All data were plotted as averages with variance as standard error of the mean (SEM) unless stated otherwise. Statistical analysis was performed by Prism (Graphpad Software Inc.). For all quantitative measurements, normal distribution was assumed, t-tests were performed with unpaired and two-sided unless otherwise stated. At least three independent replicated were analyzed.