Skip to main content

Table 1 Primers used for qRT-PCR

From: Downregulation of amphiregulin improves cardiac hypertrophy via attenuating oxidative stress and apoptosis

Gene Species Forward primer Reverse primer
Collagen I Mouse AAGAAGACATCCCTGAAGTCA TTGTGGCAGATACAGATCAAG
Collagen III Mouse TTGGGATGCAGCCACCTTG CGCAAAGGACAGATCCTGAG
TGF-β Mouse CGCAACAACGCCATCTATGA ACTGCTTCCCGAATGTCTGA
ANP Mouse CCTAAGCCCTTGTGGTGTGT CAGAGTGGGAGAGGCAAGAC
BNP Mouse AGACCCAGGCAGAGTCAGAA CAGCTCTTGAAGGACCAAGG
β-MHC Mouse CTTCAACCACCACATGTTCG TCTCGATGAGGTCAATGCAG
GAPDH Mouse CCTTCCGTGTTCCTACCCC GCCCAAGATGCCCTTCAGT
ANP Rat GAGCAAATCCCGTATACAGTGC ATCTTCTACCGGCATCTCCTCC
BNP Rat GCTGCTGGAGCTGATAAGAGAA GTTCTTTTGTAGGGCCTTGGTC
β-MHC Rat GCTGCTGGAGCTGATAAGAGAA GTTCTTTTGTAGGGCCTTGGTC
GAPDH Rat GGCACAGTCAAGGCTGAGAATG ATGGTGGTGAAGACGCCAGTA