Skip to main content

Table 2 Primers for Amplification of Sequences

From: Differentially expressed tRFs in CD5 positive relapsed & refractory diffuse large B cell lymphoma and the bioinformatic analysis for their potential clinical use

 Bidirectional primer sequencesAnnealing temperature (°C)Length of the product (bp)
U6 (reference gene)F:5’GCTTCGGCAGCACATATACTAAAAT3’
R:5’CGCTTCACGAATTTGCGTGTCAT3’
6089
AS-tDR-000045F:5′ GTCCGACGATCGTCAGGATG3’
R:5′ GTGTGCTCTTCCGATCTGCTC3’
6044
AS-tDR-008640F:5′ TACAGTCCGACGATCGAAGC3’
R:5′ TGTGCTCTTCCGATCTGAAATAA3’
6051
AS-tDR-008946F:5′ CTACAGTCCGACGATCTCCG3’
R:5′ CTCTTCCGATCTCGGTCCTT3’
6045
AS-tDR-011395F:5′ GTTAACCGAAAGGTTGGTGGTA3’
R:5′ CCGATCTACTCAGTAATGGTAACG3’
6049
AS-tDR-011461F:5′ CTACAGTCCGACGATCAGGG3’
R:5′ TGCTCTTCCGATCTACGAGAAT3’
6047
AS-tDR-013487F:5′ ATCGCTAAGGAAGTCCTGTGC3’
R:5′ TGTGCTCTTCCGATCTGCTG3’
6042
AS-tDR-013492F:5′ AGTCCGACGATCCTGTCACG3’
R:5′ GTGTGCTCTTCCGATCTTGTCT3’
6046
AS-tDR-007217F:5′ AGTCCGACGATCGCATTGTG3’
R:5′ CTCTTCCGATCTGGCGAGAAT3’
6054
AS-tDR-003278F:5′ ACAGTCCGACGATCTAGAATTCTC3’
R:5′ CTCTTCCGATCTCGTGGCAG3’
6046