Figure 2

Representative case showing the spread of the chromosome. ( A ) At the molecular level. The characteristic domains for the ribozymes (stars) Rep (red), Nsr (green), Npsr (magenta) and Asr (blue) are assumed to be “GAGUCUCU”, “GCUCGUAU”, “GGUUCGAU” and “GCGACUUU”, respectively. The sense chain of the chromosome (yellow triangles) has a sequence of these four domains in a tandem and circular way. The antisense chain of the chromosome (x-shapes) is complementary to the sense chain. Linear RNA chains are assumed to break more readily (involving the factor F _IB ) at sites after U and before G than other sites, which represents the self-cleavage effect between genes (“U-G” sites are avoided within the assumed gene domains mentioned above). The control (white triangles) has a circular chain with length identical to the chromosome, but without any gene domains (“GCCUUAGUGGACUCUUGAUAGCGUGGAAGUCU”). The number of nucleotide precursors’ precursors (cyan dots) is represented in a 1/64 scale (i.e., quotients in measurement of the mass of a sense chain and an antisense chain of the chromosome, which have 32 nucleotide residues each). ( B ) At the cellular level. Black circles represent total protocells. Yellow circles represent protocells containing at least one molecule of the chromosome (sense chain). Amphiphile precursors (black dots) are represented in a 1/600 scale (i.e., quotients in measurement of the lower limit of amphiphiles to form a protocell membrane, L _AM ). The parameter values for this case are listed in Table 1. The random seed is 9.